lenticrispr v2 construct (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
lenticrispr v2 construct
Lenticrispr V2 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+v2+construct/lentiCRISPR+v2+(Plasmid+%2352961)/pm41806318-305-11-18
Average 96 stars, based on 6129 article reviews
Lenticrispr V2 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6129 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+v2+construct/lentiCRISPR+v2+(Plasmid+%2352961)/pm41806318-305-11-18
Average 96 stars, based on 6129 article reviews
lenticrispr v2 construct - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Clone Assay:Article Title: Genome-wide CRISPR screening reveals ADCK3 as a key regulator in sensitizing endometrial carcinoma cells to MPA therapy. Article Snippet: The PCR products were purified and subjected to NGS by using the Novaseq 6000-PE150 platform (Novogene, Beijing). .. The oligos producing sgRNA to target ADCK3 were annealed and cloned into the Article Title: Genome-wide CRISPR screening reveals ADCK3 as a key regulator in sensitizing endometrial carcinoma cells to MPA therapy Article Snippet: The PCR products were purified and subjected to NGS by using the Novaseq 6000-PE150 platform (Novogene, Beijing). .. The oligos producing sgRNA to target ADCK3 were annealed and cloned into the Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. 353 We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines 354 deficient of either HK1 or HK2(32). sgRNA protospacer of HK1 (HK1-1: 355 GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 356 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was 357 cloned into Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines deficient of either HK1 or HK2( ). sgRNA protospacer of HK1 (HK1-1: GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into Construct:Article Title: Genome-wide CRISPR screening reveals ADCK3 as a key regulator in sensitizing endometrial carcinoma cells to MPA therapy. Article Snippet: The PCR products were purified and subjected to NGS by using the Novaseq 6000-PE150 platform (Novogene, Beijing). .. The oligos producing sgRNA to target ADCK3 were annealed and cloned into the Article Title: Genome-wide CRISPR screening reveals ADCK3 as a key regulator in sensitizing endometrial carcinoma cells to MPA therapy Article Snippet: The PCR products were purified and subjected to NGS by using the Novaseq 6000-PE150 platform (Novogene, Beijing). .. The oligos producing sgRNA to target ADCK3 were annealed and cloned into the Article Title: In Vivo CRISPR Screening Identifies the Glutamate Receptor GRIA2 as Promoting Peritoneal Metastasis of Gastric Cancer via Calcium-Dependent β-Catenin Activation. Article Snippet: Gene knockout cell lines were established employing CRISPRCas9 genome editing technology following previously published protocols. sgRNA sequences directed against GRIA2 were cloned into the lentiCRISPR v2 vector (Addgene). .. Lentiviral particles were produced through co-transfection of HEK293T cells with the Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. 353 We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines 354 deficient of either HK1 or HK2(32). sgRNA protospacer of HK1 (HK1-1: 355 GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 356 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was 357 cloned into Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. The 362 following day, 293T cells were co-transfected with Article Title: A Subset of Transposable Elements as Mechano-Response Enhancer Elements in Controlling Human Embryonic Stem Cell Fate Article Snippet: The FAM189A2 expressing construct was made by replacing the dCas9-KRAB fragment (Addgene, 89567) with the FAM189A2 sequence using the Gibson Assembly Cloning Kit. .. To delete genes, sgRNA sequences were obtained from the previous study 84 and expressed with the Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines deficient of either HK1 or HK2( ). sgRNA protospacer of HK1 (HK1-1: GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into Article Title: Oncoprotein SET-associated transcription factor ZBTB11 triggers lung cancer metastasis Article Snippet: The shRNA was constructed by using the pLKO.1-puro (Addgene, 8453) or pLKO.1-blast (Addgene, 26655) vector. .. The ZBTB11-iKO construct was generated by cloning sgRNA targeting ZBTB11 into a modified Produced:Article Title: In Vivo CRISPR Screening Identifies the Glutamate Receptor GRIA2 as Promoting Peritoneal Metastasis of Gastric Cancer via Calcium-Dependent β-Catenin Activation. Article Snippet: Gene knockout cell lines were established employing CRISPRCas9 genome editing technology following previously published protocols. sgRNA sequences directed against GRIA2 were cloned into the lentiCRISPR v2 vector (Addgene). .. Lentiviral particles were produced through co-transfection of HEK293T cells with the CRISPR:Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. 353 We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines 354 deficient of either HK1 or HK2(32). sgRNA protospacer of HK1 (HK1-1: 355 GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 356 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was 357 cloned into Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines deficient of either HK1 or HK2( ). sgRNA protospacer of HK1 (HK1-1: GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into Knock-Out:Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. 353 We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines 354 deficient of either HK1 or HK2(32). sgRNA protospacer of HK1 (HK1-1: 355 GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 356 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was 357 cloned into Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines deficient of either HK1 or HK2( ). sgRNA protospacer of HK1 (HK1-1: GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into Sequencing:Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. 353 We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines 354 deficient of either HK1 or HK2(32). sgRNA protospacer of HK1 (HK1-1: 355 GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 356 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was 357 cloned into Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines deficient of either HK1 or HK2( ). sgRNA protospacer of HK1 (HK1-1: GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into Control:Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. 353 We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines 354 deficient of either HK1 or HK2(32). sgRNA protospacer of HK1 (HK1-1: 355 GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 356 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was 357 cloned into Article Title: A Compound that Inhibits Glycolysis in Prostate Cancer Controls Growth of Advanced Prostate Cancer Article Snippet: .. We used a CRISPR/Cas9 approach to establish a stable knockout LNCaP cell lines deficient of either HK1 or HK2( ). sgRNA protospacer of HK1 (HK1-1: GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into Generated:Article Title: Oncoprotein SET-associated transcription factor ZBTB11 triggers lung cancer metastasis Article Snippet: The shRNA was constructed by using the pLKO.1-puro (Addgene, 8453) or pLKO.1-blast (Addgene, 26655) vector. .. The ZBTB11-iKO construct was generated by cloning sgRNA targeting ZBTB11 into a modified Cloning:Article Title: Oncoprotein SET-associated transcription factor ZBTB11 triggers lung cancer metastasis Article Snippet: The shRNA was constructed by using the pLKO.1-puro (Addgene, 8453) or pLKO.1-blast (Addgene, 26655) vector. .. The ZBTB11-iKO construct was generated by cloning sgRNA targeting ZBTB11 into a modified Modification:Article Title: Oncoprotein SET-associated transcription factor ZBTB11 triggers lung cancer metastasis Article Snippet: The shRNA was constructed by using the pLKO.1-puro (Addgene, 8453) or pLKO.1-blast (Addgene, 26655) vector. .. The ZBTB11-iKO construct was generated by cloning sgRNA targeting ZBTB11 into a modified |